Strings 2

Use functions from the string module or from base Python to print the following strings.

1. species in all capital letters
2. gcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgg with all of the occurences of a replaced with A
3. ”    Thank goodness it’s Friday” without the leading white space (i.e., without the spaces before Thank)
4. The number of a’s in gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg.
5. Print the length of this dna sequence gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg